Filopodia Formation Induced by Active Mdia2/drf3 1

Filopodia formation induced by active mDia2/Drf3. Summary: Filopodia are rod-shaped cell surface protrusions composed of a parallel bundle of actin filaments. Since filopodia frequently emanate from lamellipodia, it has been proposed that they form exclusively by the convergence and elongation of actin filaments generated in lamellipodia networks. However, filopodia form without Arp2/3-complex, which is essential for lamellipodia formation, indicating that actin filaments in filopodia may be generated by other nucleators. Here we analysed the effects of ectopic expression of GFP-tagged full length or a constitutively active variant of the human formin mDia2/Drf3. In contrast to the full-length molecule, which did not affect cell behaviour and was entirely cytosolic, active Drf3 lacking the C-terminal regulatory region (Drf3ΔDAD) induced the formation of filopodia and accumulated at their tips. Low expression of Drf3ΔDAD induced rod-shaped or tapered filopodia, whereas overexpression resulted in multiple, club-shaped filopodia. The clubs were filled with densely bundled actin filaments, whose number but not packing density decreased further away from the tip. Interestingly, clubs frequently increased in width after protrusion beyond the cell periphery, which correlated with increased amounts of Drf3ΔDAD at their tips. These data suggest Drf3-induced filopodia form and extend by de novo nucleation of actin filaments instead of convergent elongation. Finally, Drf3ΔDAD also induced the formation of unusual, lamellipodia-like structures, which contained both lamellipodial markers and the prominent filopodial protein fascin. Microarray analyses revealed highly variable Drf3 expression levels in different commonly used cell lines, reflecting the need for more detailed analyses of the functions of distinct formins in actin cytoskeleton turnover and different cell types. Sequences coding for N-and C-terminal fragments of human Drf3 were amplified from the cDNA clones BX649186 and BC048963 respectively, which were obtained from the Resource Centre of the German Human Genome Project (RZPD, Berlin). PCR fragments were combined using the internal BstXI restriction site and fused into the BglII and EcoRI sites of pEGFP-C1 (Clontech, Palo Alto, USA). Primers were as follows: DRF3 fwd GAGAGGATCCAAGATGGAACGGCACCAGCC, Drf3 rev GAGGAATTCTTAATACGGTTTATTAC, Drf3 internal fwd GAGAGATCTATGGAGGAGAGGAGC, Drf3 internal rev GAGAAGATCCACGGCTTTGGCCAATAAGGAA. The C-terminally deleted active Drf3 (Drf3ΔDAD) was generated by replacement of a PCR-amplified ClaI/SalI fragment (primers: Drf3mut fwd GAGGAAGATATTGAAGAGAAGAAATCGATTAAGA and Drf3mut rev CGCGTCGACTTTATTAATCACCCTCAGTCTTCATTTCTAATAAACG) lacking residues 1056-1110. Cells and Transfections. B16-F1 mouse melanoma cells (ATTC CRL-6323) and VA-13 human lung fibroblasts (ATCC CCL-75.1) were grown in DMEM high glucose (Gibco) supplemented with 10% FCS (EU, PAA, Austria), 2mM glutamine and penicillin/streptomycin, and transfected over night …